Friday, December 27, 2019
Gun Control Laws Should Not Be Prohibited - 897 Words
Mass shootings and suicides have become a serious occurrence from yearly to daily basis. With all these casualties, most of them were unarmed and killed by some sort of weapon. The outcomes of these events would have been different if they were carrying a gun. The possibilities of protecting themselves would be greater than if they did not. Obviously, having a legal weapon can help protect you and your love ones from a dangerous situation. Throughout history, men have been using and keeping weapons in their homes, which the 2nd Amendment claim that citizens have the right to bear arms. Gun control laws should not be prohibited, but in this case, more strict. Have you, as a citizen, ever wondered what would happen if a burglar broke into your home and in seconds, had you at gunpoint. There is nothing can be done but remain as a hostage in your own home. In a different scenario, those few seconds can help you access your weapon and be ready for any kind of situation. Carrying a weapon in your home protects your family and your property from any types of danger. Having a gun gives them at least a fighting chance in the event that a burglar or home invader manages to get in (Pros and Cons). Other than reinforcing doors and windows, having a gun would be the best choice in protecting your home. Not only that, guns can actually protect from something greater. Mass shootings can occur anywhere these days. We, as citizens of this country, have no idea where these events occur soShow MoreRelatedIs Gun Ownership a Right?1214 Words à |à 5 Pagespeople kill people, or do guns kill people? According to the U.S. Constitution, the Second Amendment states that the right to bear arms should not altered.(Bill of Rights). Many American citizens believe this amendment is an individual right, while others believe that it is only a collective right intended to restrict Congress from taking away a states right to self-defense. This, along with other current events, has given rise to heated debate on the topic of gun control. History has shown that thereRead MoreEssay about Too Much Gun Control in the United States1630 Words à |à 7 Pages à à à à à Do you like guns or would like to own a gun? Would like to have a gun for self protection if the time comes? If so the gun control laws could cause you not to be able to. For that reason gun control laws are way too strict. Some of the elderly that live alone look to guns as self defense. That is way is why I believe there shouldnââ¬â¢t be so much gun control. à à à à à Approximately 2.5 million times a year guns are used in self defense. There is about 62,200 victims of violent crimes one percentRead MoreDo People kill People, or do Guns Kill People1705 Words à |à 7 PagesAmendment states that the right to bear arms should not be altered.(Bill of Rights). Many American citizens believe this amendment is an individual right, while others believe that it is a collective right intended to restrict Congress from taking away a states right to self-defense. This, along with other current events, has given rise to heated debate on the topic of gun control. History has shown that there are positive and negative effects of gun control laws and high profile events that have leadRead MoreOutline Of An Outline On The Gun Ownership Of The United States Essay1241 Words à |à 5 PagesComposition 101 2 December 2016 To Conceal or Repeal: Gun Control in The United States The United States, where guns are as American as apple pie (Cramer). In America, gun ownership is a tradition older than the country itself and is protected by the Second Amendment. Many believe that more gun control laws would infringe upon the right to bear arms. In the United States, there are around 89 guns for every 100 people, and about 270,000,000 guns in the whole nation, which is the highest total numberRead MoreEssay about Gun Control Problems and Solutions968 Words à |à 4 Pages The problem with guns is fairly obvious: they decrease the difficulty of killing or injuring a person. In Jeffrey A. Roths Firearms and Violence (NIJ Research in Brief, February 1994), he points out the obvious dangers. About 60 percent of all murder victims in the United States in 1989 (about 12,000 people) were killed with firearms. Firearm attacks injured another 70,000 victims, some of whom were left permanently disabled. In 1985, the cost of shootings was an estimated $14 billion nati onwideRead MoreGun Control1030 Words à |à 5 PagesJoscelyn Garcia English 1301 Instructor: Nancy Cassano Essay 2 2/13/2013 Gun Control in America The United States government should have the authority to restrict and regulate American citizens from buying or owning firearms. Gun Control laws are necessary in a state because they decrease violence and increase government protection in the state. Gun laws are the cause of much violent crime in America, and they need to be changed to better background checks, tracking the movement and saleRead More Gun Ownership and Gun Control in Canada Essay857 Words à |à 4 PagesGun Ownership and Gun Control in Canada The Oscar-won documentary ââ¬ËBowling for Columbineââ¬â¢ has aroused peopleââ¬â¢s awareness of gun ownership and gun control issues. Should gun ownership be banned or should guns be controlled? Does gun ownership create a violent society? The answer is not measurable, however, from the firearm situation between America and Canada, the answer is more obvious. America probably has the highest rate of gun ownership in the world. In CanadaRead MoreThe Pros And Cons Of Gun Control1474 Words à |à 6 PagesGun control laws are an ongoing process that varies from location, to time of history. Throughout history different laws and regulations have been made about gun control across all continents on earth. These laws change frequently and will continue to do so till the end of time. Many people are either for or against these laws depending on their religion, moral beliefs and location. Although increasing gun control is used for the protection of citizens, it could be deemed unnecessary to many becauseRead MoreThe History Of Gun Control1605 Words à |à 7 Pagesââ¬Å"In 1939, Germany established gun control. From 1939 to 1945, six million Jews and seven million others unable to defend themselves were exterminated.â⬠Joe Wurzelbacher. The history of gun control legislation started in the 1920s-1930, which made it so that the states and congress could make laws on gun s, before this congress had no say on guns and this made it possible for them to create laws. The National Firearm Act of 1934 made it so that owners must register any sawed-off shotguns with the TreasuryRead MoreArgumentative Essay Gun Control1410 Words à |à 6 Pagesnew proposed gun control laws in the aftermath of the massacre at Sandy Hook Elementary School in Newton, Connecticut that occurred on December 14th, 2012. This incident claimed the lives of twenty 1st graders and six adults and has set the government in motion to try to prevent future acts of violence by strengthening gun control laws in the United States (Smith). This has been a topic that has been an extremely emotional debate with people on both sides unwilling to compromise. Gun advocates and
Thursday, December 19, 2019
The United States Of America - 909 Words
The United States of America, a country that used fight for the small guy, that used fight to protect the people that needed to be saved. Yet now we can barely save ourselves from a water balloon fight. This country got caught up in the small thing .We are fighting ourselves about bathroom rules, being democrat or a republican. Recently people are making a deal about the pledge of allegiance some people who don t believe in a religion or have a different region than most people in this country. As a Kant deontologist I would say that we need to remove those worlds from the pledge of allegiances for the greater good. Kant would say if every one is not on abroad with the same idea. So the best thing we can do is while doing the pledge of allegiance to pay our respect for the people who died and who are fighting for this country. If you do not want to say just keep quite during that part. Yet this is such a first world problem. You would not care if you were in a third world country. If you were stuck in that situation you would be fight how to feed your kids and not fighting about three words that do mean anything. People who fighting about this should be fight for better equity for every body in this country. In Kant words we are using other people as mirrors me instead of other humans. We are trying to be the center of the universal when we are not. We have seen so many people write facebook rants that are basically novels. Do you actually think that would changeShow MoreRelatedThe United States Of America1536 Words à |à 7 PagesThe United States of America is well known throughout the world for tis democracy ant the freedoms of its citizens. Since declaring its Independence from Great Britain rule in 1776, the United States of America has undergone a continuous effort to maintain law and order. In order to create a strong federal government with a system of check and balances the Constitution was proposed and ratified. The Constitution of the United States became the Supreme law of the land. (The Constitution) We theRead MoreThe United States Of America1317 Words à |à 6 PagesThe united states of america has been in many world affairs since its creation. One of the earliest international events that can be attributed to having direct links with the Great Depression was the Manchurian Crisis of 1931. War had broken out be tween China and Japan, who had both suffered due to the counter measures and high tariffs set by America and Europe to combat the Great Depression. Japanese army officers in Manchuria manufactured an incident, took over the province and on their own createdRead MoreThe United States Of America995 Words à |à 4 PagesThe United States of America has always been known as the home of ââ¬Å"The American Dreamâ⬠. This consists of the nice house with the family, the dog and the white picket fence. Lately, however, the country has been losing this dream. Lately the corruption of the United States of America has taken over this dream that led so many to want to make a home in the country. Politics has become a contest of money and power. Money has come to equal power, and it shown through all elections. The Federal ElectionRead MoreThe United States Of America1551 Words à |à 7 Pages The United States of America: the place that praises the ââ¬Å" American Dreamâ⬠that count less people try following but never really succeed in accomplishing because of systemic racism. Itââ¬â¢s easy to tell people to pull themselves up by their bootstraps, but what if they donââ¬â¢t even have bootstraps to begin with? The American Dream is a sugar coated lie. After hundreds of years of colonization, mass genocide, racism, white supremacyâ⬠¦ It is deceptive to tell minorities that they can be as successful asRead MoreThe United States Of America Essay1694 Words à |à 7 PagesA crash in america may be coming a lot sooner than many people think. The United States of America is facing problems a lot of people are either unaware of or just dont think its a big deal. Most of america think that our economy and government is in alright financial shape, That may not be the case though. America is in bad shape and it seems to be going down hill. America is declining in world power as well and this is just another factor leading to a crash in the future. Other nations are growingRead MoreThe United States Of America1244 Words à |à 5 PagesFrom Northern Pakistan to The United States of America, The Exchange Student Probably to everybodyââ¬â¢s shock, nobody could have imagined how poorly executed the 45thââ¬â¢s President Executive Order shortly after it was established. Any person, who is from one of the seven designated Muslim countries in the Middle East, are not allowed the right of entry into the United States of America. People like Syrian Refuges are ban indefinitely until the 46th POTUS reverses that order, who are seeking nothing butRead MoreThe United States Of America1674 Words à |à 7 PagesThe United States of America is the world largest single economy with a lot of trade activities with other nations. The country has traded with other nations for centuries hence it is an important economic partner (Jensen, Quinn Weymouth, 2015). The country normally has a lot of influence in the world trade since it serves almost all the nations worldwide. In fact, most of the trade policies that affect the whole world have been proposed by the United States of America. Moreover, the count ry isRead MoreThe United States Of America1354 Words à |à 6 Pages The United States of America was sought out by immigrants as a place of freedom and refuge. Throughout America s short history, people from all over the world looked to America as a land of opportunity. Immigrants from Eastern European countries such as Poland, Lithuania, and Hungary poured into the United States in the mid 19th century. The large amount of immigration from Eastern European countries to the United States between 1919 and 1924 was due not only to the opportunities of work and freedomRead MoreThe United States Of America938 Words à |à 4 PagesThe United States of America is one of, if not the most developed nation in the world as of 2014. America is well-known for its freedom and opportunity it offers, which is why many individuals sought out for it. But I am not going to write about Americaââ¬â¢s many achievements and prestigious comforts. I would like to address the current situation that h as been haunting America for quite some time now. In the last century, technology all around the world has undergone dramatic changes, whether it isRead MoreThe United States Of America1340 Words à |à 6 PagesThe journey of how the United States of America became the United States of America is a very complex one. With America declaring separation from the Great English Empire, to the organization of becoming a free, sovereign nation and lastly, the migration and colonization of the now, western United States, including the great state of Nevada, has many components. The Declaration of Independence initiated the process of becoming a country of its own. This Document pushed the separation from England
Wednesday, December 11, 2019
My last duchess Essay Example For Students
My last duchess Essay In these ten very elemental lines of the poem, Browning successfully exposes the true motives of his speaker, the duke, through his voice of reason at play during conversation with a potential father-in-law. At this point in the text, his audience discovers the reasons for his failed marriage with his former wife, and also learns of her faults. The speaker is obviously bothered by his wifes wanton ways as she was too soon made glad,/ too easily impressed; she liked whateer/ She looked on, and her looks went everywhere(lines 22-25). He had much to offer her, not excluding his prestigious nine-hundred-years-old name (l. 33). As an appreciator of the finer things and high society, he was disturbed by how easily entertained and amused she was by others and their little efforts. The duke is bothered by her nonchalant ways and cannot understand her excitement over the bough of cherries some officious fool/ Broke in the orchard for her(l. 27-28). As if his efforts werent enough! Browning also successfully accomplishes his task as a dramatic monologue with the careful use of words and punctuation. The rushed speech with exclamation points adds to the speakers continuing disbelief in his former wifes priorities. He is astounded by her practice and misgivings while interjecting his own speech with excitable lines to lure the reader. The duke is unwilling to share the dirty details of the foul relationship, but is eager to explain the situation even if it defaces their credibility or his as a valuable member of society. He shares with his listener the tendencies of her heart how shall I say? too soon made glad(l. 23), and although he seems almost reluctant, the reader may also interpret his tone as somewhat fescicious or bitter. This passage is key to the text as a whole because it directly relates the past of the duke with the desires of his future. He tells the story of what went wrong, and what he needs from the man hes currently making negotiations with.
Tuesday, December 3, 2019
Management and Social Media Strategies free essay sample
Consider for a moment a midlevel manager at a multinational foods company, Fatima, who would seem to be at the top of her career. Sheââ¬â¢s consistently making her required benchmarks and goals, she has built successful relationships with colleagues, and senior management have identified her as ââ¬Å"high potential. â⬠But she isnââ¬â¢t happy with her work. Sheââ¬â¢d be much more interested in understanding how her organization can use social media in marketing efforts. Ideally, sheââ¬â¢d like to quit and find something that better suits her passions, but in the current economic environment this may not be an option. So she has decided to proactively reconfigure her current job. Fatima is part of a movement toward job ââ¬Å"crafting,â⬠which is the process of deliberately reorganizing your job so that it better fits your motives, strengths, and passions. The core of job crafting is creating diagrams of day-to-day activities with a coach. We will write a custom essay sample on Management and Social Media Strategies or any similar topic specifically for you Do Not WasteYour Time HIRE WRITER Only 13.90 / page Then you and the coach collaboratively identify which tasks fit with your personal passions, and which tend to drain motivation and satisfaction. Next the client and coach work together to imagine ways to emphasize preferred activities and de-emphasize those that are less interesting. Many people engaged in job crafting find that upon deeper consideration, they have more control over their work than they thought. So how did Fatima craft her job? She first noticed that she was spending too much of her time monitoring her teamââ¬â¢s performance and answering team questions, and not enough time working on the creative projects that inspire her. She then considered how to modify her relationship with the team so that these activities incorporated her passion for social media strategies, with team activities more centered around developing new marketing. She also identified members of her team who might be able to help her implement these new strategies and directed her interactions with these individuals toward her new goals. As a result, not only has her engagement in her work increased, but she has also developed new ideas that are being recognized and advanced within the organization. In sum, she has found that by actively and creatively examining her work, she has been able to craft her current job into one that is truly satisfying. 1. Why do you think many people are in jobs that are not satisfying? Do organizations help people craft satisfying and motivating jobs, and if not, why not? I think people are in jobs that are not satisfying because of a possible tough financial situation or an accommodating work schedule. In addition, I believe that firms do try to create satisfying jobs by incorporating a number of elements including job enrichment, job rotation, job education, and job training as methods to make job satisfaction higher. 2. Think about how you might reorient yourself to your own job. Are the principles of job crafting described above relevant to your work? Why or why not? I currently work at the Office of Undergraduate Admissions in Jackson Hall. The principles of job crafting described above are not relevant to my work because Fatima holds a higher position than I do. Her higher position allows her to share and implement her new social media strategies with members of her staff. In contrast to Fatimaââ¬â¢s midlevel management position, my work-study position does not offer the same amount of flexibility. Thus, my current situation does not allow me to craft my ideal job. 3. Some contend that job crafting sounds good in principle but is not necessarily available to everyone. What types of jobs are probably not amenable to job crafting activities? The types of jobs that are probably not amenable to job crafting activities include highly routine jobs such as assembly line worker and customer service representative. 4. Are there any potential drawbacks to the job crafting approach? How can these concerns be minimized? A potential drawback to the job crafting approach would be the erosion of focus on the job to be done. The modification of the job methods may lead to more inefficient ways of completing the task, and therefore, a loss of productivity. These concerns can be minimized by closely supervising the amount of production.
Wednesday, November 27, 2019
Beauty And The Beast Gender Roles Essays - , Term Papers
Beauty And The Beast: Gender Roles Marian Belle is the main character, she lives with her father who is considered by the town a loony man therefore, Belle is also looked upon the town as being a little out of the ordinary. Even so, she is the most beautiful girl in the town, her name means beauty and it is shown with her wonderful appearance throughout the duration of the movie. Gaston a very courageous and dignified worrier, who is in love with Belle and wishes to marry her. Moreover every women and man in the town look up to him and would do anything for him. Nonetheless, Belle sees right through his beauty and recognizes him as a mean and conceded fool who does not know how to love. Meanwhile there is a prince in a near by castle who wakes up to a widow knocking on his door. When he answers she offers him a rose for shelter out of the cold. When he consistently said no the widow turned into a prices. He tried to apologize but it was too late. The curse of the flower turned him into a beast. Consequently, the curse can not be broken until he finds a woman to love him from within instead of just his outside appearance. Little does the audience know that feminism is displayed throughout the entire movie, for example Belle is walking through town one day and I noticed vital parts of the film displaying old traditional methods of living with the man working for a living while the wife stays home and takes care of the house and the children. When I reiterated the part over and over I noticed more and more displays of such chauvinistic nature. For instance, It seemed very odd that the men of the town were only paying attention to the pretty women and saying hello to them. Not to mention, how the men ordered around the women like slaves. I totally disagree with this way of life and think Disney should have thought greatly before displaying such difference between women and men. Similarly, you have a scene with a widow holding about four kids begging a man for six cents in which the man was just shoving her off like a dog or cat. After all, this is just the first scene in the movie. Personally I never rea lized this horrible display of feminism until I paid a little closer attention to what is going on around the main characters. Meanwhile, as Belle is finishing her walk through the chauvinistic town, Justin jumps in font of her grasping the book she was peacefully reading and says ?Its not right for a women to read then they start to get ideas and thinking.? If this were a statement made by a stubborn political figure back in the 1800's I would understand because that was just how things tend to work back then. However, this is a movie written in the 1990's for children to watch seventy years after women got the vote and were recognized to be equal to men. Nonetheless, I probably doubt that most children who view this movie look at it in a chauvinistic way but if they did recognize the feminism towards women it would upset them. Adults on the other hand, pick up on these inessential parts of the movie and are struck with disappointment. As I viewed the movie and realized what was actually going on it hurt me to think that in such an innocent movie things of this nature take place. Indeed, this is just the fi rst few signs of feminism. Sadly but surely the events that lead me to think of feminism and chauvinism we have just had a sample. AS we go further in dept into the movie Justin proposes to Belle after very rudely forcing himself into her house. The proposal is a surprise to Belle but the whole town thinks of it as no big deal that she is oblivious to the proposal. As Justin is asking Belle to marry him he reminisces on how great their life would be together stating ?Picture this my latest kill on the fire and my
Sunday, November 24, 2019
Privatisation of Telstra essays
Privatisation of Telstra essays What are the advantages of privatising Telstra and how does this impact it's ethical conduct while striving to satisfy community expectations? I believe that putting important public assets into select private hands is not in Australia's long-term interests, and oppose the partial/full sale of Telstra for the reasons that the Government has given. The argument the Government has given for the privatisation and corporatisation of Telstra has been a budget conscious one where the proceeds of Telstra will provide a "one-off" opportunity to: 1) abolish Telstra's pastoral call rate and provide untimed local calls in extended zones in remote Australia; 2) increase funding for Networking the nation; and 3) pay off foreign debt left over by the previous government However, this is not true as the Minister, Senator Alston already has the power to direct Telstra to provide services and upgrade infrastructure (points 1 and 2). If the USO (Universal Service Obligations Act) or performance standards under the CSG need changing, then the Minister should invoke his power to direct, and these changes should be made distinct from any attempts to sell Telstra. Statistics also show that the sale of the first third netted a total of $0.37 billion loss to the Commonwealth. By the year 2000, it is estimated that Telstra earnings will exceed $2 billion annually. The Howard Government estimats an interest saving of about $2.4 billion per year. This doesn't take into account the income that will be lost to the government every year in revenue earnings from Telstra. By 2007, the sale of Telstra is expected to create a budget black hole of $4 billion. The government cites that the "Mums and Dads" of Australia will benefit by purchasing shares in the float, which is true. But eventually the real beneficiaries will be the multinational companies who will have the controlling majority, not the Australian public. This can have detrime...
Thursday, November 21, 2019
Research Article Analysis Paper Example | Topics and Well Written Essays - 1000 words
Article Analysis - Research Paper Example The research realizes a need to draw comparative judgment between various European jurisdictions in order to identify the differences in juvenile criminal procedure and reforms which exist specially after the devolution within the UK. Design The design of the research is mostly analytical with comparisons drawn between the differing localities and the legislations between them. Since the United Kingdom engulfs several legal entities within it such as Ireland, Wales, and England, comparisons are quickly drawn between the ways the same law is adjudicated within these countries. It utilizes the constitution as a source while considering the conventions of the United Nations as well as the devolved legislations as supplementary sources. The research does comprise statistical figures but mainly draws from scholarly articles and official documents that contain the requisite legal information, such as the Constitution and the Home Office documents. The emphasis is on the effect of such laws on juvenile delinquency and hence, incorporates statistical figures of young criminals between the four primary United Kingdom territories of Scotland, England, Ireland, and Wales. Operational Definition of Juvenile The youth is distinguished from juveniles with respect to legal terminology and as such, juveniles are those children to whom criminal sanctions may be awarded as appropriated by the law of the respective country in which the crime is committed. In criminal terms, juveniles in England are considered to be children between the ages of 12 and 18 where as in Scotland, they fall between the age of 10 and 16. Inductive logic The devolution of the National Assemblies to Ireland and Wales has resulted in separate punitive measures with regards to criminal justice such that each country in the United Kingdom (England, Ireland, Wales and Scotland) has its own set of policies governing the youth justice system as well as their welfare. The differences exist as a result of the aim within jurisdictions to strike a balance between ââ¬Å"rights compliance, cost-effectiveness, prevention, early intervention, diversion, social inclusion, treatments or punishmentâ⬠(Muncie) keeping local perspectives in mind. Thus, it is concluded that there can be no concrete measure to establish a uniform legal order with regards to the youth justice system across the United Kingdom. Deductive logic The research also states the impact of having a separate legislature within a devolved regime. Since Scotland has its own parliament and is therefore independent of the parliament of England and Wales, it enacts its own laws that pertain to juvenile justice. It abolished juvenile courts and promoted youth correction by a process known as hearing, which essentially involved laymen as judges accompanied by officials that promoted child welfare and criminal correction. However, while this process has been credited as pioneering, Scotland is still trying the highest number of young criminals aged between 16 and 18 in the United Kingdom, that too in adult courts subject to adult criminal sanctions. Thus, the research concludes that a separate parliament/legislature does not equate to better juvenile justice structure or a safer discourse for children. Nature of study: Quantitative or Qualitative The study conducts a qualitative analysis of scholarly resources as well as official documents in order to draw comparisons between the juvenile justice systems of
Wednesday, November 20, 2019
At Home in Montana Essay Example | Topics and Well Written Essays - 250 words
At Home in Montana - Essay Example For this reason, Thomas moved from Colorado where he had lived with his family for more than 23 years. In Montana, Thomas established a studio in his compound near the riverbank where he carries out his artistic work. Thomas indicates that remaining humble in his work remains the most fundamental objective in his life. Hence, he seeks to have his work improved and more appealing than the previous work. In line with this, Thomas started humbly displaying his artwork in shopping malls, hotels, conventions, and other humbling places as he honed his skills to become the esteemed artist. Effectively, his work features in international exhibitions despite Thomas failing to attend an art class as his artistic skill is self-taught with his highest education certificate being a degree in business. Nonetheless, Thomas ensures that his artwork represents certain themes that depict various aspects of life among them different range of values, shadows, effects of light, and softness and hardness that represent aspects of life. 3 Dec. 2012.
Sunday, November 17, 2019
Managing diversity and equal opportunity Essay Example | Topics and Well Written Essays - 3000 words
Managing diversity and equal opportunity - Essay Example However, diversity is a concept that is more inclusive. People do not merely differ owing to their nationality, ethnicity or skin colour. People may also differ in their physical abilities, age, gender, sexual orientation, mental abilities and religious beliefs. In that context, diversity is a more holistic concept that it includes multiculturalism and all other notions by which people may differ from each other. Diversity could be a problem if taken to be so, or it may turn out to be a source of ingenuity, creativity and innovation if managed in the right way (Burke & Cooper 2005). So the chief and pivotal concern of diversity management is to make the diversity visible as well as to manage diversity in a way that it turns out to be fruitful, beneficial and salubrious fort the society, institutions and organizations. The core concern of diversity management is the appreciation of diversity as well as, wrought out the associated organizational and institutional behavioural changes in a way that they end up being beneficial and salubrious (Burke & Cooper 2005). Diversity is a concept that forces the managers and the employees to rethink their social and managerial views and expectations. Although the codification of organizational and institutional behaviour and modes of reference do help people size up their world view in a definite manner, these set views may also turn out to be sources of discrimination for some sections of the society. Considering the fact that the workforce in the UK is increasingly becoming multicultural, this has forced the organizations to restructure and rethink their attitudes and notions regarding diversity, so as to assure that everybody gets equal access to opportunities for growth and self realization. Understanding Diversity Diversity could turn out to be a benign and salubrious asset for any community. However, in a broader context, diversity happens to be much more than merely inculcating tolerance, and abstaining from resorting to stereotyping or getting judgemental. In fact in a world given to variety and variation, recognizing and managing diversity makes an immense sense. Diversity constitutes the fundamental asset for a society given to variation and stands to be central to the development of the economy and culture. It is the reverence for human dignity, freedom to differ and the liberty to express different views is what makes an organization inclusive and modern (Burke & Cooper 2005). The chance to perform and work in a way that is in consonance with what an individual actually is ensues from a realization of the relevance of the whole and the recognition of the constituent subsections. One of the plus points of recognizing diversity and differences is that it leads to recognition of the diversity and the inclusion of the varied diverse segment of the society in the workforce active in institutions and organizations (Burke & Cooper 2005). Creating a work environment that recognizes diversity allows people to realize each otherââ¬â¢s innate differences and similarities, and to be able to relate to each other through this understanding. Cross-cultural integration and the communication today play a central role in the management of employees and customers. Not only the workforce in the UK is getting highly diverse, the consumers and customers that access the goods and services produced by
Friday, November 15, 2019
Immune System of a Plant
Immune System of a Plant ABSTRACT Two light signalling factors, FAR-RED ELONGATED HYPOCOTYL3 (FHY3) and FAR-RED IMPAIRED RESPONSE 1 (FAR1) regulate chlorophyll biosynthesis, seedling growth and modulate plant immunity by controlling HEMB1 expression in Arabiopsis thaliana. We show that fhy3 far1 double null mutants display high levels of reactive oxygen species, salicylic acid and high expression of pathogen related genes. We analyse the effects of this constitutively activated immune response on commensal microbial communities through use of a next generation sequencing based approach. We determine that fhy3 far1 mutants contain greater species diversity and a greater resistance against pathogenic bacteria. Fungal pathogens increase in abundance in fhy3 far1 mutants. Taken together, this study demonstrates the important role of FHY3 and FAR1 in commensal microbial community composition as well as the importance of bacterial fungal relations. INTRODUCTION The Microbiome Microorganisms are an extremely diverse group of organisms; making up an astonishing 60% of the Earths total biomass (Singh, 2009). Soil sustains as many as 4-51030 microbial cells (Singh, 2009), all contributing to soil structure formation, decomposition, and recycling of organic matter into its constituent elements and nutrients. Microorganisms present in the soil adjacent to plant roots are part of the Rhizosphere. (Garbeva, 2004) highlights their pivotal roles in the suppression of plant disease (Badri DV, 2009), promotion of plant growth (Lugtenberg, 2009), development and health (Mendes, 2011). Leaves usually dominate the aerial part of the plant, representing of the most significant terrestrial habitats for microorganisms: the Phyllosphere (Vorholt JA, 2012). A diverse community of bacteria and fungi inhabit this challenging habitat; with nutrient deficiency and fluctuations in temperature, humidity and UV radiation (Lindow SE, 2003). The microbial communities here are shaped by biotic factors: (Yang CH, 2001) states that species, genotype (van Overbeek L, 2008) and age of plant (Redford AJ, 2009) all have their respective impacts. Abiotic factors also have a profound influence over the communities present within the phyllosphere. Plant location and growth conditions such as soil composition and climate can also have a strong impact due to the physiochemical alterations they impart. (JH, 1999) also notes how plant genotype and phenotype has an impact on community assembly. Although the majority of communities exist on the plant surface, and are therefore epiphytic some exist within the plant as endophytes. Species present within the phyllosphere tend to assimilate plant derived ammonium, simple carbohydrates and amino acids, which are their primary nitrogen and carbon sources (Thomas R Turner, 2013). Microorganisms energy metabolism isnt entirely dependent on the plant; some species contain rhodopsins. Due to the abundance of processes which play a role in community composition (Weiher E, 2011), phyla with the best adaptations for survival and reproduction tend to predominate communities. These microorganisms can promote plant growth through the production of hormones, or protect plants from pathogenic organisms by producing antibiotic compounds, competing for resources (Berg G, 2009) or induction of systemic resistance (Conrath U, 2006). The use of Arabidopsis thaliana as a model organism has been vital for these studies (Innerebner G, 2011). A. thaliana is an annual forb, occurring at temperate regions worldwide in a diverse range of habitats (Elena Garcà a, 2013) In order to analyse microbial communities; a few terms need to be defined. Biodiversity is defined as the range of significantly different types of organisms and their respective relative abundance within a community, encompassing three main levels; genetic variation between species, number of respective species and community or ecological diversity (Harpole, 2010). Two main components make up species diversity: the total number of species present (species richness) and the distribution of individuals amongst said species (evenness). Operational taxonomic units (OTU) or communities provide information on an ecosystem (Mannan, 2013). Species diversity relates to the stability of a community; well organized communities tend to have the greatest stability (Yannarell, 2005). Stresses can cause disturbances in a homeostatic community, thereby disrupting it and leading to changes in species abundances. When characterizing an ecosystem such as A. thaliana, one must determine three things: T he type of microorganisms present, their roles and how these roles relate to the ecosystems function (Sani, 2011). Plant Immune Response The immune system of a plant has a selective effect upon its microbiome. Upon pathogen encounter, a plant will elicit an immune response with the goal of limiting pathogen growth. Biotrophic and hemibiotrophic pathogens (those who obtain nutrients from living host tissue) are repelled by Salicylic acid dependent defence responses. Necrotrophic pathogens (which kill their host to obtain nutrients) are sensitive to Jasmonic acid (JA) and Ethylene (ET) dependent defence responses (Christine Vogel, 2016). Plants lack specialised immune cells; therefore, their cells must have an ability to sense pathogens and mount an appropriate immune response. Pathogens are detected by pattern recognition receptors (PRRs) which bind to the microbe or pathogen associated molecular patterns (MAMP/PAMP), thereby issuing a layer of basal defence known as PAMP triggered immunity (PTI) to prevent pathogen colonization (Chuanfu An, 2011). In order for pathogens to cause disease, they must inject effectors int o plant cells, thereby interfering with PRR complexes or downstream signalling to overcome the PTI. Plants have evolved resistance proteins which recognise effectors directly or indirectly and induce effector triggered immunity (ETI). This response is far more specific, and is often followed by a hypersensitive response (HR). R proteins, mostly leucine-rich repeat (LRR) domain containing proteins and Nucleotide-binding (NB) proteins are the intracellular receptors which sense pathogen derived molecules (Heidrich K, 2012). Figure 1 shows a summary of these processes. When these proteins are activated, production of salicylic acid occurs. Salicylic acid (SA) is a phenolic phytochrome present in plants. SA holds roles in growth, development, transpiration, photosynthesis and the uptake of ions. Its also vital for the process of endogenous signalling, mediating plant defence against pathogens. Activation of defence signalling pathways causes the generation of mobile signals from the infected tissue, where they can spread to distal tissue. Here they can upregulate expression of pathogenesis related genes and induce systematic acquired resistance (SAR), a long-lasting immunity against a broad spectrum of pathogens. Sali cylic acid mediated immune responses are important factors of both PTI and ETI, essential for the activation of SAR. NB-LRR mediated disease resistance may only be effective against pathogens grown on living host tissue such as obligate or hemibiotrophic pathogens, but not against nectrotrophs (Dangl, 2006). Downstream of the NB-LRR R proteins, the pathways ENHANCED DISEASE SUSCEPTIILITY1 (EDS1) and its partner PHYTOALEXIN DEFICIENT 4 (PAD4) act in basal resistance and ETI initiated by Toll-like/Interleukin 1 receptor (TIR) type NB-LRR R proteins (Vlot AC, 2009). Both PAD4 and EDS1 amplify SA signalling through a positive feedback loop (Wanqing Wang, 2015). Coiled-coil (CC) type NB-LRR proteins are regulated by NONSPECIFIC DISEASE RESISTANCE 1. When SA levels increase as a result of pathogen challenge, redox changes are induced which cause reduction of NON EXPRESSOR OF PATHOGENESIS-RELATED GENES 1 (NPR1) to a monomeric form which activates defence responsive gene expression by accumulating within the nucleus. This results in plant immunity (Fu ZQ, 2013). Most bacteria which colonize A. thaliana are not pathogenic however still produce MAMPs. It is currently not known how plants are able to tell apart pathogenic and commensal microorganisms, and whether the recognition of these non-pathogenic phyllosphere bacteria triggers plant immune signalling networks downstream of PTI or ETI activation, with knock on effects on community structure. (Christine Vogel, 2016) determined that in response to some non pathogenic species, the detection of MAMPS leads to no change in gene expression. Note that some species of bacteria can induce transcriptional changes to protect the plants from infections of other species (Judith E. van de Mortel, 2012). FHY3 FAR1 Plants have developed regulatory mechanisms in order to cope with adverse abiotic and biotic conditions (Bray EA, 2000), however these are a detriment to their growth and development. These regulatory mechanisms activate immune responses and resistance pathways in the case of biotic stress. Constitutive activation of plant immunity would lead to impaired growth and fitness, so in the absence of stress, the immune response must revert the massive transcriptional reprograming, requiring tight genetic control (Tian D, 2003). Arabidopsis thaliana has to adapt to changes of environmental stimuli, such as light signals or temperature. Light duration, direction, wavelength, and quantity are determined by a battery photoreceptors which monitor incident red (R, 600-700 nm) and far red (FR, 700-750 nm) light wavelengths. This is achieved by switching between R absorbing and FR absorbing modes through biologically inactive Pr and active Pfr forms (PH, 2002). Photo activation of the primary photoreceptor for FR light phyA, causes translocation from the cytoplasm to the nucleus. This translocation allows induction of FR-responsive gene expression required for various photoreceptors. Two pairs of homologous genes are essential for the phyA signalling; FAR1 (far-red-impaired response 1) and FHY3 (far-red elongated hypocotyl 3). (Hudson, 2003) determined that these genes encode mutator like transposase derived transcription factors which directly bind to the promotor region HEMB1, which itself encodes a 5-1minolevuli nic acid dehydratase, ALAD) and activates its expression, thereby regulating both chlorophyll biosynthesis and seedling growth (Tang W, 2012). These regulators small plant specific proteins, which are necessary for the nuclear accumulation of light activated phyA. (Wanqing Wang, 2015) determined that fhy3 far1 double null mutants display an autoimmune response; accumulating SA and ROS, inducing PR genes and having an increased resistance to pathogen infection. They all displayed a dwarf phenotype, with necrotic lesions developing on their leaves as a result of premature cell death. Wang and his colleagues determined that FHY3 and FAR1 may act as defence-responsive gene repressors; mutants had high abundances of R genes and upregulated levels of PR genes, hinting at a possible link with regulation of NB-LRR mediated SA signalling pathways. Fhy3 far1 mutants increased expression levels of EDS1, PAD4, SID2 and EDS5 all genes involved in SA pathways. Reduction of HEMB1 in fhy3 far1 lead to a constitutively activated immune response, inducing system acquired resistance. (Wang Q, 2007) hypothesized that FHY3 and FAR1 may negatively regulate SA signalling and plant immunity through regulation of HEMB1 expression providing a possible linkage between light signalling and plant immunity. Next Generation Sequencing Most microbial communities present within nature are yet to be cultured within a laboratory; thereby leaving biomolecules such as nucleic acids, proteins, and lipids as our only source of information. For phylogenetic studies, surveys of the small ribosomal subunits (SSUs) for bacteria and the internal transcribed spacer (ITS) region of fungi are vital. Ribosomal genes are present in all organisms and contain regions which evolve slowly, coupled with faster evolving regions which permit fine tuning of taxonomic levels, to either family or genera. Note, that there also exists numerous databases for reference sequences and their respective taxonomies, such as SILVA (Pruesse, 2007) and the Ribosomal Database Project. This technique uses multiple primer pairs for each of the marker genes, each associated with its own taxon (William Walters, 2015). SSU rRNA genes are the standard reference sequence for taxonomic classification; calculating similarity between rRNAs. ITS regions are primari ly sequenced for fungi due to the higher degree of variation they display as a result of low evolutionary pressure, and clear resolution below genus level (Bellemain, 2010). PCR amplification is performed, cloning and Illumina sequencing of the bacterial 16S rRNA and fungal 18S ITS performed and compared to databases hosted by NCBI to allow a benchmark for assessment of phylogeny (Cole JR, 2009). Illumina sequencing was chosen due to the low cost and sequencing quality (Gregory B. Gloor, 2010). (Wang Q, 2007) determined that longer sequences are easier to assign to taxonomic groups, in this case, reads of 300bp were determined. Illumina sequencing has two main technologies: HISEQ, which generates more reads but requires a longer time, and MISEQ which provides less reads but at a longer sequence length, reduced time and reduced cost, hence its use in this experiment. The workflow of Illumina has four basic steps; a sequencing library is produced by random fragmentation of DNA/cDNA samples, followed by ligation of 5 and 3 adapters. These adapters are amplified through polymerase chain reaction (PCR) and the gel purified. Libraries are loaded onto flow cells, binding to a lawn of surface bound oligonucleotides which are complementary to the library adapters. Each of these fragments is amplified into distinct clonal clusters by the process of bridge amplification. Single bases ar e then incorporated into DNA template strands. All the 4 reversible dNTPs are present during sequencing, natural competition reduces incorporation bias, thereby reducing error rates. Data analysis involves alignment of new identified sequence reads with a reference genome (Illumina, 2016). Predictions A previous understanding of the microbial communities to be expected on wild type Arabidopsis thaliana was vital in order to discern changes in community composition of fhy3 far1 double null mutant plants. Numerous studies have been performed to determine the microbiome of the rhizosphere and phyllosphere, mostly through the use of fingerprinting and clone libraries (Reisberg EE, 2012). Arabidopsis thaliana microbial communities have been studied at a genome wide level (Matthew W. Horton, 2014), due to potential ecological and agricultural interest particularly when it comes to micro biotic resistance. (Matthew W. Horton, 2014) determined that in wildtype Arabdopsis, the majority of OUTs are from families of Proteobacteria, Bacterioidetes and Actinobacteria. Common genera included Sphingomonas, Flavobacterium, Rhizobium and Pseudomonas. (J.M. Whipps, 2007) determined that the phylosphere was dominated by Alpharoteobacteria, Gammaproteobacteria and Bacteroidetes. Betaproteobacteria and firmicutes have also been noted to be present at high abundances. Acidobacteria, Actinobacteria and cyanobacteria have all been found in low abundances (J.M. Whipps, 2007). Fungal OUTs tend to be from Ascomycete classes Dothideomycetes and Sordariomycetes and the basidiomycete class Tremellomycets (Matthew W. Horton, 2014). A study by (Delmotte N, 2009) analysed what bacterial communities are most abundant in naturally occurring A. thaliana phyllosphere and discovered Methylobacterium, Sphingomonas and Pseudomonas to be the most prevalent. Commensals belonging to the genus Sphingomonas have been linked with protecting plants from pathogens (Innerebner G, 2011). Many of the genera are pathogenic; such as Epicoccum, Alternaria, Mycospharella, Fusarium and Plectspharella..Interestingly, a lot of these genera are seed transmitted, suggesting a reason for their permanent association with A. thaliana. Microbial communities are largely shaped around host genetics, with changes in genes relating to defence response yielding the greatest changes in microbial communities. Due to the fhy3 far1 double null mutants constitutively activated immune response, one can assume that the plant will have an enhanced resistance against pathogenic organisms. Materials and Methods Plant Material, Growth Conditions and Extraction of Phyllospheric Microbes The fhy3 far1 double null mutant line of Arabidopsis thaliana with a Nossen (No-0) ecotype was obtained from the Xing Wang Deng group at Yale university, New Haven, USA (Wang and Deng, 2002). Double mutant plant lines fhy3-4 and far1-2 were produced through 1-Methylsulfonyloxyethane (EMS)-mutagenesis by Hudson et al (1999). Plants displayed a dwarfism phenotype, necrotic lesions on their leaves and accumulation of both ROS and SA. Plants were grown in standard controlled environment chambers in white light at a Photon Flux Density of 164 à µmol m-2 s-1 in short day conditions which correspond to 8 hours of light and 16 hours of darkness for 4 weeks. Plants were grown on a compost mixture consisting of 6 parts Levington M3 (Scotts, UK), 6 parts John Innes number 3 (Westland, UK), and 1 part (Sinclair, UK). Phyllospheric microbes were extracted according to the protocol from Zhou et al (1996). The above ground growing parts from at least six plants were pooled for each sample. 100 mg of above ground growing parts of WT and fhy3 far1 mutant plants, 2.7 ml of DNA extraction buffer and 10 à µl of proteinase K (10 mg/ml) were added in falcon tubes. Tubes were shaken horizontally at 225rpm at RT for 30 mins. 0.3 ml of 5% SDS was added and tubes were incubated at 65à °C for 2 h with gentle mixing. The samples were centrifuged at 6,00 g for 10 min at RT and supernatants were collected. Pellets were extracted two more times after addition of 0.8 ml of extraction buffer and 20 à µl of 5 % SDS. Tubes were vortexed for 10 sec, incubated at 65à °C for 10 min and centrifuged. Supernatants from all three cycles of extractions were combined and mixed with equal volumes of chloroform-isoamyl alcohol (24:1, vol/vol). The aqueous phase was recovered by centrifugation and precipitated with 0.6 volume of isopropanol at RT for 1 h. The pellet of crude nucleic acids was obtained by centrifugation at 16,000g for 20 min at RT. The pellet was washed with ice cold 70 % ethanol, dried at 37à °C and resuspended in sterile deionized water for a final volume of 500 à µl. DNA extraction buffer contained 100 mM Tris-HCl (pH 8.0), 100 mM sodium EDTA (pH 8.0), 100 mM sodium phosphate (pH 8.0), 1.5 M NaCl and 1% CTAB. PCR for High-throughput Sequencing and Sequencing Analysis PCRs for bacteria and fungi rDNA-related sequences were performed in volumes of 20 à µl, with 1 x GoTaq Flexi Buffer, 1.5 mM MgCl2, 200 à µM dNTPs, 0.2 à µM forward primer, 0.2 à µM reverse primer, 1.25 units of GoTaq Flexi DNA Polymerase, 1 à µl colony suspension and distilled water. To amplify bacterial 16S rDNA and reduced mitochondria- and chloroplast-specific rDNA-amplicons, two PCRs were run. PCR primer pair 63f 63f (5-CAGGCCTAACACATGCAAGTC-3) / 1492r (5-GGCTACCTTGTTACGACTT-3) used for amplification of bacterial, mitochondria and chloroplast specific rDNA amplicons. The degenerative primer 783r (5-CTACCVGGGTATCTAATCCBG-3) is a mix of nine primers (783r-a1 (CTACCAGGGTATCTAATCCTG), 783r-b1 (CTACCGGGGTATCTAATCCCG), 783r-c1 (CTACCCGGGTATCTAATCCGG), and 783r-a2 (CTACCGGGGTATCTAATCCTG), 783r-b2 (CTACCCGGGTATCTAATCCCG), 783r-c2 (CTACCAGGGTATCTAATCCGG), and 783r-a3 (CTACCCGGGTATCTAATCCTG), 783r-b3 (CTACCAGGGTATCTAATCCCG), 783r-c3 (CTACCGGGGTATCTAATCCGG)). The degenerative primer 783r was designed to reduce amplification of chloroplast 16S rDNA (Sakai et al., 2004). For amplification of fungal intergenic spacers, the primer ITS1-F (CTTGGTCATTTAGAGGAAGTAA) and ITS2 (GCTGCGTTCTTCATCGATGC) (White et al., 1990) were used. Eventually, 200 ng of DNA per sample, consisting of 100 ng DNA from bacteria-specific primer PCR and 100 ng DNA from fungi-specific primer PCR, were sent for high-throughput sequencing using the Illumina MiSeq platform to the Department of Epidemiology and Biostatistics, Institute for Computational Biology, Case Western Reserve University, Ohio, USA. Data processing Samples S13 and S15 consisted of sequences from the fhy3 far1 double null mutant whilst samples S14 and S16 belonged to the wild type Arabidopsis thaliana. A collective total of 182218 and 496243 sequences were present for fhy3 far1 and wildtype samples respectively. The first 20,000 sequences of each of the four samples were retrieved from the raw FASTQ data files using the cut feature of NextGen Sequence Workbench (Heracle BioSoft, 2016). FASTQC High Throughput Sequence QC Report v0.11.5 (Simon Andrews, 2011-15) was used to analyse sequence quality. FASTQ sequences were converted to FASTA format with FASTQ to FASTA converter from the Galaxy platform (Gordon, 2016). Sequences with a Phred quality score under 20 were trimmed using default parameters of Trim Galore! (Krueger, 2016). Paired end reads were trimmed to discard the leading 8bp barcode. VSearch was used for sample dereplication (Rognes Torbjà ¸rn, 2015). Due to the composite nature of the samples (containing both bacterial and fungal reads), a method had to be devised to separate them. SILVAngs was used to provide data analysis for 16S bacterial amplicon reads through an automatic software pipeline using the SILVA rDNA database (Quast C, 2013). SILVAngs was unable to process the 18S ITS fungal sequences. Through the SILVA output, recognised bacterial sequences were determined for each sample. Using NextGen Sequence Workbench (Heracle BioSoft, 2016), these recognised bacterial sequences could be marked as contaminants and removed from the raw FASTA sequence data files, thereby leaving the fungal reads. Basic Local Alignment Search Tool from NCBI were used on the FASTA sequences (Altschul, 1990). Parameters were altered so that only the ten most similar alignments were retrieved per sequence. A pipeline was built using python and local copies of mapping files maintained by GenBank (Dennis A. Benson, 2005): ftp://ftp.ncbi.nih.gov/pub/taxonomy/gi_taxid_nucl.dmp.gz for corresponding taxonomic IDs for GIDs and ftp://ftp.ncbi.nih.gov/pub/taxonomy/taxdump.tar.gz for matching taxonomic ID to scientific names. The pipeline functioned by converting genbank IDs to taxonomic ID and abundance count. The taxanomic ID was then matched to scientific names and defined to a taxonomic hierarchy. Sequences with an abundance under 3 were removed as singletons. Sequences assigned to A. thaliana chloroplast 16S rRNA gene or mitochondria were removed. Statistical analysis For diversity computation, samples were rarefied to the sample with the lowest sampling effort (3390 for fungal and 4988 for bacterial). Diversity indices, richness estimators, rarefaction curves and eigenvector techniques such as principal component analysis were all performed using PAST 3.14 (Hammer, 2001). Wilcoxon Signed-Rank test was performed using IBM SPSS Statistics (IBM Corp, 2013). Heatmaps were generated using (Wahlestedt, 2016). Krona plug in was used for abundancy chats (Ondov BD, 2011) Results Statistical Analysis of Bacterial Communities Statistical analysis at a genus level indicated the following. Rarefaction curves showed a lack of sampling depth in fhy3far1. Diversity t tests determined that fhy3 far1 mutants displayed a greater diversity in comparison to wildtype A. thaliana, with a Shannon index of 3.51 and 2.85 respectively. Dominance values indicate that wild type A. thaliana contained select few genera which dominated the sample size. Simpson_1-D indicated that fhy3 far1 mutants possessed the greatest amount of sample diversity, though only marginally (0.95 and 0.91 respectively), whilst Evenness was highest in wildtype. Shannon index determined that fhy3 far1 samples had greater alpha diversity, confirmed by a Chao-1 score of 222.7, indicating greater species richness. Beta diversity was also greater in fhy3 far1. Alpha diversity indices are all displayed in table 1. Wilcoxon Signed-Rank test was performed with the null hypothesis that wild type and fhy3 far1 samples would contain similar bacterial community composition. The results indicate that the fhy3 far1 plant had 165 species with a higher abundance than in wild type A. thaliana. Test statistics indicated that fhy3 far1 contained a statistical difference in microbial abundances (P Principal component analysis at a phylum level revealed that PC 1 (98.5%) and PC2 (1.46%) were able to explain 99% of the variation. The result indicated a higher association of Baceroidetes and Acidobacteriales with fhy3 far1, separating it from the wild type which had higher correlation with Actinobacteria and Firmicutes. At a genus level (figure 2), wild type A. thaliana is correlated with Bacillales, Bacillus, Brevibacterium, Sphingomonas, Rhizobiales and Lysobacter. Genera associated with fhy3 far1 were determined to be Devosia, Advenella, Chitinophaga, Shinella, Rhizobium, Pricia and Pedobacter. Discussion Despite Arabidopsis thaliana having been studied for over 20 years in respect to the mechanisms of its immune responses (Kunkel, 1996), its not until the works of (Joel M. Kniskern, 2007) and (Matthew W. Horton, 2014) that an insight into the natural bacterial and fungal communities of A. thaliana was made. The aims of this project were to determine the commensal bacterial and fungal communities of A. thaliana and investigate the effect of the fhy3 far1 mutants constitutively activated immune response on said communities. In this study, we characterized the phyllosphere of wild type and fhy3 far1 mutant Arabidopsis thaliana using an Illumina sequencing survey of 16S rRNA and 18S ITS genes. To explain the results observed, we had to examine the effects of a constitutively activated immune response. The fhy3 far1 double null mutant has no way of negatively regulating SA signalling, this is due to the fact that FHY3 and FAR1 negatively regulate both stress and defence responsive genes, some of which are involved in the SA signalling pathway (EDS1, SID2, PAD4 and NDR1) (Wanqing Wang, 2015). This also induced the expression of a large amount of CC-NB-LRR and TIR-NB-LRR type R proteins. Many of these R genes will encode for protein homologs which mediate resistance against specific genera of bacteria and fungi. Some gene products can contain pathogen growth by indirect means; reinforcing the defensive capabilities of host cell walls and inducing stomatal closure (Jorg Durner, 1997). Alternatively, R gene products which have direct effects are usually antimicrobial metabolites (phytoalexins), papillae formation and induction of JA signalling and HR. Due to ETI being a direct tailored response to specific effectors detected by R proteins, it stands to reason that the activation of R genes will have a more profound effect on pathogenic species producing effectors. ETI commonly leads to an apoptic hypersensitive response, as observed by the necrotic lesions (Jorg Durner, 1997). As non-pathogenic species are unlikely to produce effectors (Toni J. Mohr, 2008), they wont receive an ETI response and therefore may be resistant to the immune response. Alternatively, non-pathogenic species may possess a suite of effector proteins which allow the nonpathogen to overcome some host defence systems (Grennan, 2006).The reactive oxygen species accumulation can be seen as the plants establishment of defence, strengthening host cell walls by cross linking glycoproteins, or act as executioners of pathogens by lipid peroxidation and membrane damage (Miguel Angel Torres, 2006). Alternatively, it may function as a plant signalling molecule, much in the likes of salicylic aci d. Constitutive immune activation reduces abundance of pathogenic bacteria, but not pathogenic fungi. Interestingly, we discovered that fhy3 far1 A. thaliana plants showed a decreased abundance of bacterial species associated with pathogenesis, thereby indicating that the effector triggered immunity response was effective and targeted towards pathogens. We were not able to show a specificity in plant response to non-pathogenic bacteria, as these too were affected by the ETI, seemingly without discrimination. Numerous reports indicate that the effects of plant defence processes on the microbiome are variable, with SAR being responsible for controlling the populations of some bacteria. (John W. Hein 2008) determined significant differences in rhizopshere bacterial community composition in A. thaliana mutants deficient in systemic acquired resistance (SAR), however, direct chemical activation of SAR by (Peter A.H.M. Bakker, 2013) caused little difference in community composition. (Joel M. Kniskern, 2007) analysed the effects of salicylic acid mediated defense induction, simmilarly to wh at we have tried to show in this experiment, conclusing a change in phyllospheric communities; notable a reduction in deiversity of endophytes, but higher epiphytic diversity, in concordance with our findings. We also concluded that the mutants constitutively activated immune response had no real effect on pathogenic fungi, in fact- the mutant hosted an increased abundance of pathogenic fungi. This was unusual due to the assumption that ETI would be targeted towards these species. This hints at the possibility that fungal communities are shaped by the bacterial communities present on the plant. It has been noted that SA and SAR do not contribute to resistance to necrotrophic pathogens (Joanna Ãâ¦Ã azà ´niewska, 2010), however some literature contradicts our findings. Bacterial community diversity is increased in fhy3 far1 A. thaliana Our initial survey of the wild type bacterial communities of A. thaliana in samples 14 and samples 16 revealed a disparity in initial composition, however a Wilcoxon Signed Ranks test indicated no statistically significant difference between the two. 91 different morphotypes were detected and assigned to species on the basis of 16S sequence alignment. The most abundant species, Bacillales and Bacillus from the order Bacillalesare unusual in that they have not been previously described in A. thaliana. These high abundances are only from Sample 14, and were not observed in Sample 16. This may be a sequencing error or alternatively due to contamination. Bacillus have been described as mutually beneficial rhizobacterium in some plants; providing plants with growth promoting traits (Nathaniel A. Lyngwi, 2016). The Gammaproteobacteria of the genera Pseudomonas were found in a high abundance, a result which coincides with the literature (Matthew W. Horton, 2014) (J.M. Whipps, 2007). (Fumiaki Katagiri, 2002) has noted that Pseudomonas syringae is pathogenic to A. thaliana, triggering a hypersensitive response (HR) a rapid associated death of plant cells. The fhy3 far1 mutant showed a severe decrease in abundance; which could be associated to the over expression of Arabidopsis R genes: RPS2, RPM1, RPS4, RPS5 and PBS1, which mostly belong to nucleotide binding site-leucine rich repeat classes of R genes (Fumiaki Katagiri, 2002). (Wanqin
Tuesday, November 12, 2019
Yellow Ribbon Project
PR Assignment 1 Background Sheet: Generating Yellow Ribbon Project Campaign Awareness 1. About the Organization: Singapore Prison Services Singapore Prison Services (SPS) is a division of the Singapore Police Force that concentrates on the care and rehabilitation of prisoners who have committed social or criminal offences. The organization does not merely concentrate on housing and providing guidance for inmates while they are in remand, it is also dedicated to ensure that no repeat offences ensue. Thus, a major portion of their efforts also concentrate on providing inmates with basic employment skills in hopes of preventing past criminal behaviour from surfacing upon their release into society. This indicates that the SPS provides preventive and after-care measures to maintain former prison inmates compliance with the law as much as possible. (Source: http://www. prisons. gov. sg/about_us. html) 2. About the PR Situation In 2005, SPS services realized that former inmates released into society faced social stigma in the form of negative public opinions of being ex-offenders and are often denied employment or rejected by society. Such public opinions are harmful and repressive. Seitel (1998, pp50) describes Public Opinion as the aggregate of many individual opinions on a particular issue that affects a group of people by forming consensus or popular attitudes and thoughts. The role of the PR practitioner then is to positively influence an individualââ¬â¢s attitude. As seen in the above definition, public opinions represent popular thoughts that can prove an inmateââ¬â¢s re-integration into society a daunting task. Without the means of finding acceptance or a proper means of living, many relapse back into a life of crime, a paradox that can be resolved through a public relations campaign that aims to educate and seek acceptance. As such, the Yellow Ribbon Project as a public relations campaign in a long-term program that sought to change public perceptions of ex-offenders was launched in order to deliver a second chance. In this situation, the SPS has been providing culinary training to a group of inmates in conjunction with Raffles Hotel (Singapore) that has culminated in a cooking competition. A renowned chef has been at helm in training them and he has marvelled at their ability to pick up skills in a short time. The newsworthiness of this initiative begins with prison inmates partaking in a grand cooking competition not unlike the Iron Chef series. Thus, a Media release highlighting the background of the cooking competition and a feature article in the form of a personality profile written by an SPS Public Relations Executive will be provided for the purposes of fulfilling this assignment. 3. Reasons for Using PR Communication: 3. 1 Media Release: It is deemed that to generate positive publicity and awareness of the ââ¬Ëbizarreââ¬â¢ cooking competition in conjunction with this yearââ¬â¢s Yellow Ribbon Project (YRP), a media release will be sent to newspaper editors in Singapore in hope that the story will be printed and generate interest and positive awareness. A media release has been described by Seitel (1998, pp175) as a document of record to state an organizationââ¬â¢s official position or to influence a publication to write favourably about the material discussed and stimulate editors to cover a story. As readers tend to perceive news articles with more credibility, it is hoped that the use of a media release information transformed into a news article will fulfil the communicative objectives of the YRP better in terms of reach and credibility than using an advertisement or provision of information on the organizationââ¬â¢s website. 3. Feature Article-Personality Profile: For the second communication tool, a personality profile of a former prison inmate who has found moderate success as a food hawker will be written by an SPS Public Affairs executive and published in a local Singapore Newspaper, The Straits Times special edition that covers the YRP in October. In addition, the personality profile will also be posted on the SPS we bsite for maximum coverage. A feature article has been described by Seitel (1998, pp203) as articles found in magazines or newspapers that are the opposite of hard news items, often light, humorous or enlightening. In this scenario, the feature article is utilized to disseminate less newsworthy (there is less news-worth in a story about a former convict turned cook) information in more subtle ways to break misconceptions that ex-offenders, like leopards, never change spots. The feature article is thus useful when less important information needs to be conveyed to the publics of a PR campaign that nevertheless, represents a supporting communication device in meeting campaign objectives. References: Seitel, FP, 1998, The Practice of Public Relations, 7th edn, Prentice-Hall, NY, USA. FOR IMMEDIATE RELEASE (LOGO) INMATES SHOWCASE CULINARY TALENT AT FIRST-EVER YELLOW RIBBON COOKING COMPETITION Singapore, September 9, 2010 ââ¬â Twelve inmates pit their culinary skills against one another in the Yellow Ribbon Cooking Competition held in Changi Prison Cluster A today. This milestone activity is the first in a series of Yellow Ribbon Project activities in 2007, organised by the Community Action for the Rehabilitation of Ex-Offenders (CARE) Network. The cooking competition was jointly organised by Raffles Hotel. Chef de Cuisine Jean-Charles Dubois from the hotelââ¬â¢s French fine-dining restaurant Raffles Grill was one of the judges at todayââ¬â¢s finals and was also heavily involved in preparing the inmates for the competition. This cooking competition simulates the kitchen environment and challenges faced by professional chefs. Participants were required to produce an original Western-style dish within a strict three-hour limit using predetermined ingredients and equipment. The participants showed promise and a genuine eagerness to learn, and this experience has been rewarding as I have been able to see the improvements they have been able to make,â⬠said Chef Dubois. To prepare participants for the competition, Chef Dubois visited the institutions five times and provided video instruction to introduce the ingredients and cooking methods to the inmates. ââ¬Å"The participation of inmates in this competition further reaffirms their determination to contribute to their families and society. Weââ¬â¢re proud to have our inmatesââ¬â¢ creation featured at the prestigious Raffles Hotel. Chef Duboisââ¬â¢ contribution to our inmates also shows that the community is willing to take the lead in helping inmates in their rehabilitation and reintegration,â⬠said Mr. Desmond Chin, Chairman, Yellow Ribbon Project Organising Committee. Winning recipes will also be recreated at a special reunion lunch, A Tribute of Love, to be held in three daysââ¬â¢ time for winners and their family members. Raffles Hotel will also feature the best dish on a Raffles menu, making it available to her patrons and guests. *ENDS* About Yellow Ribbon Project The Yellow Ribbon Project is a nation-wide campaign to raise the awareness of Singaporeans about the need of inmates, ex-offenders and their families for societal acceptance. For more information, please contact: Jale Byrd, Executive Public Affairs Branch, Singapore Prison Service Telephone: 6565-6565 Email: [emailà protected] gov. sg From The Fire Into The Frying Pan By Jale Byrd The bang and clatter you hear when you step into the hawker centre at Ang Mo Kio Avenue 10 is undeniably a dragonââ¬â¢s roar. Rueburn Liangââ¬â¢s Chia Song Fried Kway Teow stall, which he has operated for the past 13 years, is synonymous with good food. It is also the most prolific stall at the busy food centre. The setup comes complete with a portable television and loud speakers that broadcast the latest soccer and professional wrestling matches. ââ¬Å"Frying a good plate of Char Kway Teow is an art. I bang loudly on the edge of my wok to attract customers to my stall. The TV keeps them entertained,â⬠booms Rueburn, as he gesticulates with his charred spatula. Loud, vociferous and a former Ang Soon Tong (a Secret Society in Singapore) enforcer, you will be inclined to agree. Rueburn is a karate expert plastered with tattoos of flaming dragons over his massive frame, which are made conspicuous with his well-greased white singlet. The missing last finger on his right hand makes the manââ¬â¢s dark, pockmarked face even more intimidating. But lest you get alarmed, Rueburnââ¬â¢s lashings are taken out on his trusty wok, where he conjures mouth-watering plates of delicious, spicy and sinful Char Kway Teow. ââ¬Å"I had to chop off my last finger as a ââ¬Ësettlementââ¬â¢ for leaving the society in 1987, and a $800 Ang Pow (a red packet containing money, is seen as an auspicious sign by the Chinese),â⬠he reveals without a hint of regret. Otherwise, ââ¬Ëtheyââ¬â¢ will never leave me alone. Now, those days are over. Luckily, some of those people respect me, never really give me trouble. â⬠(A secret society member has to sever a finger to maintain his code of honour and pay an ââ¬Ëexit feeââ¬â¢ to leave the underground organizati on without fear of repercussions) With all his dubious activities, an inevitable brush with the law saw Rueburn put behind bars for nine months. Rueburn broke the arm, skull and penis of a credit defaulter in a savage fight. The bone-breaking experience threw him into the ââ¬Ëfireââ¬â¢ of Queenstown gaol, a humbling experience for the former gangster. I really got burnt by the prison ââ¬Ëfireââ¬â¢. We were made to kneel and live in a mini-hell. Sipeh Chor leh (Really Tough) Outside, I was a ââ¬Ëterrorââ¬â¢, but the others were hardened criminals and I seemed like a sissy compared to them. I didnââ¬â¢t want to spend my life strolling in and out of jail. Sio jit pai kow liow! (Getting burnt once was enough) I decided it was good for me to leave the society and turn to a decent living. I was right,â⬠says Rueburn with hindsight. (The criminal slang for serving time in prison is ââ¬Ëtio her sioââ¬â¢ or getting burnt by fire) Rueburn, who only completed pr imary education, was at a loss. The only decent job he was good at was cooking. His vocation as a military cook in the Singapore Armed Forces during his national service in 1983 cemented his culinary passion and served him in good stead. At the encouragement of his then girlfriend Fion (now Mrs Liang) and some savings, he successfully bid for a hawker stall and set up Chia Song in 1988. However, he learnt to perfect his Kway Teow frying skills only much later. ââ¬Å"Not easy to fry a good plate. True, it looks easy but I had to experiment many times before I was satisfiedâ⬠¦now, I think I am getting there,â⬠Rueburn says modestly. Getting there? Itââ¬â¢s very good already! One of the best in Singapore! â⬠quips Elson Boey, a retired civil servant. ââ¬Å"There is always a long queue during lunch time. I think his secret is in the intensity of his fire. â⬠Hard work as it seems, Chia Song is a labour of love. The couple dedicates 12 hours a day amidst unforgiving flames to create a uniquely Si ngaporean masterpiece. ââ¬Å"The fire must always be strong and the leow (ingredients) must be fresh! Timing is also very important, as you do not want to overcook the dish. Bah You (pork lard) must be used liberally, as it gives that special taste. You only live once ah, so live it good! No need to be so healthy one. â⬠Indeed, words of culinary and hedonistic wisdom. It is lunchtime and an almost scandalous crowd forms. A haze of smoke clouds the sizzling sound of stir-fried garlic as they simmer in a pool of aromatic lard. Chee Seng furiously stirs in his noodles and kway teow into a heated wok smoldering under a furious fire. Within moments, arrays of delicious condiments are thrown into the fray, soaking in the thick flavour. When the rich smell of caramelized sweet sauce wafts under your nostrils, Rueburn has served another satisfied customer. A stolen glance around the hawker centre reveals an assortment of harried but happy workers haphazardly sliding tantilising morsels of Fried Kway Teow down their throats. Echoing Elsonââ¬â¢s sentiments is Rachel Tua Kang, an auditor who works nearby. ââ¬Å"Simply fantabulous! My diets never take off, this temptation is too much! â⬠When told, Rueburn Liang brushes off his accolades as if they were burnt garlic bits on his flaming wok, his reddened face warms up into a big grin as he takes another drag of his Marlboro cigarettes. Ying siu nia,â⬠(they are just entertaining me) he jokingly retorts. It is closing time for the busy hawker and he takes a well-earned respite from the dayââ¬â¢s backbreaking battle with his wok and emerges at the end of the day with a rosy complexion, no doubt made pink by the tremendous temperatures he has to endure. As Mrs. Liang cleans up the slobber knocker of a hawker stall, Rueburn takes delight in a leisurely smoke. Rightfully, he see ks solace in his daily bottle of bitter-cold ABC stout. Gleefully, he chugs down a glass of the icy brew. Ha ha, these days I only fight with my wok. My life could have turned out much worse! There is no fear of getting burnt now. â⬠As he breaks into another cheerful smile, he bursts into a self-indulgent laughter, as if to remind himself of his good fortune. It is lunchtime again, and Rueburn busies himself over a brilliant hot wok. You might think a fire-breathing dragon was fueling the fire, as the flames turn to a ferocious blue fireball. However, the dragon is above the stove, controlling the fire. He has made the transaction of jumping from the fire into the frying pan.
Sunday, November 10, 2019
Does the Media Control the Public?
Media, it is the main means of communication, as radio and television, newspapers, and magazines that reach or influence people widely. Anyone who controls any form of media has vast amounts of power over the public. A simple news story can change societyââ¬â¢s opinion over a certain topic. However, without the media, we would not get an insight into controversies that are happening half way around the world. If it werenââ¬â¢t for the media, dictators would not be brought to their knees, and answer to the crimes that they have committed. Whether we know it on a conscious level or not, we are being influenced by the media, whether you think you are not being affected, you are at some level. It is not only about the way we look, but also the food we eat, the things we buy and our concept of happiness, love, and sadness. Everywhere one goes they see magazines, billboards, television shows, commercials etc. , and these are the things that we want in life. This is similar to the social cognitive learning theory, essentially monkey see monkey do. Trends and fashion statements are shown in the media and then society often follows them up. Children are vulnerable and susceptible to this influence from the media, especially with the amount of exposure to the level of communication, and technology that is available to them in this day and age. Companies spend millions of pounds each year on TV advertisements, so that they can sell and in return gain millions of pounds profit. This is a form of communication used to encourage or persuade an audience to perform a certain action. Advertising messages are usually viewed via various traditional media; including mass media such as newspaper, magazines, television commercial, radio advertisement, outdoor advertising or direct mail. We are accustomed to see people with rich people with skinny bodies and faces due to airbrushing and surgery, and that is what we strive for. Skinny is often seen as a luxury, a sign someone can afford the gym, and healthy foods, when many years ago being heavy was a sign of luxury, that one could afford to eat. The reason why think this way, is because of media advertising, whereas before, being ââ¬Ëbigââ¬â¢ would demonstrate your wealth as you could buy a lot of food, now being skinny is what considers you to be rich. However, it is not only the companies that use this technique to make eople buy their products, governments also use this technique to make the public commit to their ideas. During World War 2, Naziââ¬â¢s used the media to justify their course, and so did a multitude of other countries. Media manipulation has been going on for many years, and especially with todayââ¬â¢s media it is very easy to spread propaganda and even easier to make people believe it. F or example, every year, a state-owned publishing house releases several cartoons called geurim-chaek in North Korea. The plots mostly feature scheming capitalists from the United States and Japan who create dilemmas for naive North Korean characters. Governments find this very easy to make the public do what they want, without them actually knowing it consciously. As opposed to providing certain information to showcase, propaganda, in its most basic sense, presents information primarily to influence an audience. Propaganda is often dispersed over a wide variety of media in order to create a chosen influence upon the public, making sure it will be imprinted into the minds of the public. Governments would usually take the current situation, and try and manipulate them in a way that would make the opposition seem at wrong. They would also sometimes hide information from the public from the country or the world. The media can be easily changed and manipulated to suit a governmentââ¬â¢s need, just like how it can be changed to only represent one side of the argument, persuading the reader to believe what a certain media company wants them to believe in. Media bias is the perceived biasness of a certain piece of news that has been produced by journalists and news producers that are intending to persuade a certain category of people. There are three types of newspapers; right winged newspapers and left winged newspapers. Right winged news paper companies will usually be against any immigration topics and are usually very patriotic, whereas left winged newspaper companies are quite liberal and diplomatic. However there may be multiple motives for this act, and they quite discreet about which side they are on, as a common lay man would think that the newspaper is telling the truth. Many political parties have influence over a certain newspaper company that will spread their news and propaganda, trying to influence the reader to vote or to support that particular party. For example ââ¬ËThe Guardianââ¬â¢ is a left winged newspaper that is the ââ¬Ëvoiceââ¬â¢ of the Labour party at the present moment, and ââ¬ËThe Sunââ¬â¢ is more of a right winged party, and they mainly support the conservative party. It is common practice for newspapers to declare an explicit affiliation with a political party, and affiliated newspapers were explicit in representing their partyââ¬â¢s point of view, for example, on the 19th of April 1989, the Sun disgraced the Liverpool fans who had died in the Hillsborough disaster, by stating that many Liverpool fans had pick-pocketed the dead and had urinated upon the dead police officers at the scene. The Sun was supposed to have recited the very words that a Conservative MP had said in a speech. This sparked many arguments across the globe, and this can show how much damage any media company can do. Smaller newspaper companies also do the same, as they would most likely support the county that they are in, rather than supporting some other county. For example if you were to compare a football review between the two teamsââ¬â¢ local newspapers, both of them would tell a different story, as they are biased towards the side that they support. However, without the media we would not be informed about what is happening across the globe, and we would almost be ignorant to the events that are happening outside of our local area. By having media, we would be able to gather the voices of a nation, and voice our concerns about a topic. Without the media we would not be able to have any liberty to do anything we want and we would be able to fight back against multinational companies, monarchies, and governments. For example, in Libya, Muammar Gaddafi was using his own private military and army to rule over the country with fear, to dictating the country. It helps us learn more about the world as well as interacting with each other. Without the force of the country upon him voiced by the media, he was being pressured to step down; he could have still been in power today if it werenââ¬â¢t for the media. We are in an age whereby we have such amazing technology that allows us to access pretty much any point of the globe without stepping out of our house. The media helps us understand both sides of the argument, and not all of the news companies are biased. If it werenââ¬â¢t for the media, we would have been a single-minded society, only thinking a certain way. We would be able to be equal, with certain groups thinking that one group is better than another, and eventually it will end up in a fight, and then leading onto wars, for example in World War 2 (1939-1945), Adolf Hitler had discriminated the view that all Jews were ââ¬Ëparasitesââ¬â¢ and that they were stealing all of the jobs available, and that they are the reason for the bad economy. The media give us a common ground where we can all talk about, reflect and form opinions about the world at large; environmentally, politically, socially, and culturally. Without using media, politicians would not be able to convey their message across. The media also helps suffering countries in a time of despair, and warns us about casualties that have happened in an accident or disaster. The media will inform us and it could make a difference to the people in need, as it will provoke us to raise money via charities hence helping the people in need. If it werenââ¬â¢t for the media, it would be difficult for the charities to communicate their messages. However, in the end itââ¬â¢s all about our choices and what concepts we choose to subscribe to and adopt as ours. But I personally believe that media does have a big involvement in the everyday lives of the public, and we are very much influenced by that. Governments today still use the media to convey their messages. I am not stating that we donââ¬â¢t need the media; we need to have media in our lives, as it will give us a chance to interact and have knowledge about what is going on around the world. So in conclusion, I believe that although we will need the media in the future, we should not believe all of it, and we should act upon our own opinion-not something that someone else is telling us.
Friday, November 8, 2019
macbeth Theme Sharing
with Laertes and when he stabs him he unknowingly poisons him with the blade of Laertes own sword, eventually leading to his death. Although actual poison was used throughout the play, the poison of the mind was just as important. When Hamlet had learned that Claudius had killed his father for his own greed, Hamletââ¬â¢s mind was poisoned. All he could think of was a way to avenge the death of his beloved father. Later when Hamlet had accidentally killed Polonius thinking he was Claudius, Hamlet had also accidentally ââ¬Å"poisonedâ⬠two separate min... macbeth Theme Sharing Free Essays on Hamlet/macbeth Theme Sharing Theme sharing in Hamlet and Macbeth In William Shakespeareââ¬â¢s two most popular works of art, Macbeth and Hamlet, several parts of the plays are similar. These two plays can be compared easily because Shakespeare used the same formula for each of his tragedies. The tragedies use supernatural incidents to intrigue the readerââ¬â¢s interest and included in the play is a hero who has a tragic flaw, which eventually causes him to make a fatal mistake. Throughout both of these plays, Shakespeare uses the leit motif of poison, death, ambition, and appearances can be deceiving. We are first introduced to poison in Hamlet in the very beginning of the play. King Hamlet is killed when his brother, Claudius, pours poison into his ear while King Hamlet is asleep in his apple orchard. This causes a fast but excruciating death. Poison is later brought back into the play when Claudius will try to slip a poison into Hamletââ¬â¢s drink of wine. His plan backfires when his wife takes a drink from the cup instead of Hamlet and the poison eventually kills her. During the time of that incident, Hamlet is fencing with Laertes. Laertes sees that Hamlet if far beyond him in his fencing ability, so he decides to wipe the blade of his sword with a cloth soaked in poison. As the fight goes on Hamlet is cut on the arm, causing the poison to slowly seep into his blood. While they are fencing Hamlet is able to switch swords with Laertes and when he stabs him he unknowingly poisons him with the blade of Laertes own sword, eventually leading to his death. Although actual poison was used throughout the play, the poison of the mind was just as important. When Hamlet had learned that Claudius had killed his father for his own greed, Hamletââ¬â¢s mind was poisoned. All he could think of was a way to avenge the death of his beloved father. Later when Hamlet had accidentally killed Polonius thinking he was Claudius, Hamlet had also accidentally ââ¬Å"poisonedâ⬠two separate min...
Wednesday, November 6, 2019
Winning Attitude Essays - Attitude, Cheating In Video Games
Winning Attitude Essays - Attitude, Cheating In Video Games Winning Attitude A winning attitude is being a good sport. People who always brag about winning don't have a winning attitude. Not all people have a winning attitude. Although a lot do. When you play a game and a person always says that they are going to win, then they don't have a winning attitude. When you are playing a game with somebody and both of you play fair then you both have winning attitudes. A winning attitude helps alot in games. Some people only care about winning. Thats not a winning attitude. When you play a game and the other person loses, if they are all upset and angry, they should not play because they dont have a winning attitude. Sometimes people like to cheat just to win a game. When half of the time the person who cheated ends up losing. Then they look bad because they lost even though they cheated. So, don't cheat, cheaters never win. Always play fair. When you play a game don't be rude to the other player(s). And don't be rude to your own teammates. If you play a game like basketball, don't be a ballhog and not pass the ball to anyone else. Share the ball and let the team win the game, don't win the game for the team. Just one person can't win the whole game by themself. It takes a whole team to win. Teamwork is what makes the team, and what gives you, and the rest of the team a winning attitude. All of these factors are important to have a winning attitude. Even when you lose a game you still need a winning attitude. After the game go shake hands with the other team. Say good game or good job. If you or somebody you know gets all mad or upset if they lose a game tell them that they don't have a winning attitude. Even if you have a winning attitude encourage others to have one too. The more winning attitudes, the more winners, or example; After a baseball game you don't see the baseball players yelling or screaming at eachother. They ALL walk out on the field and shake hands a nd say good game. So remember, even if you win or lose, you should always have a winning attitude.
Sunday, November 3, 2019
Database Design Concepts British Insurance Company Assignment
Database Design Concepts British Insurance Company - Assignment Example The second screenshot illustrates the working of the function "Add new customer". When the system admin will click on the "Add new customer", he will be redirected to this page. The page will inquire about the following details. System Admin can also upload the picture of a customer. Once all the details have been provided, the admin will click on the "save" button in order to record the details in the database. The third screenshot illustrates the working of the Product's Section. When the system administrator will click on the "Products" button located at the in the main panel, he will be redirected to the Product's Section. Here, the admin will be able to add new Products, view existing Products, make a web search to update the product's details and delete a Product. An admin will also be able to perform a Product related search in the search box provided at the bottom of the page. When the admin will click on any of the buttons, he will be redirected to the related page.Ã Ã Screenshot 2: This Screenshot shows the working of the Product module. A manager or admin of the system can add the new product, view existing products, delete a product or make a web search to gather details for the product through the buttons on the page. A manager or admin can also make a search for any query regarding the product to make a quick search. Screenshot 3 When the admin clicks on the button "Add new customer", he will be redirected to the "Add new customer" page. The admin has to enter the mentioned details and click on the "Save" button in order to create a new customer account. Task 2A: Data Dictionary: Table Field Type Field Size Field Description Customer Text Up to 500 characters The details of the customers will be stored in the Customer table Product Memo Up To 64,000 characters The details of the customers will be stored in the Customer table Quotation Text Up to 1000 characters The quotations made by the advisors will be saved in the quotations table Advisor T ext Up to 255 characters Names of the advisors will be saved in the advisor table Task 2B: The tool used to create the ER diagram is Microsoft Visio. ER Diagram: 5 entities have been considered in the ER diagram. The product entity contains the following attributes; Description, Product No., and Name. The Database Admin entity contains the following attribute; ID Number. The Customer entity contains the following attributes; Name, reg no, age, address, contract number, date and advisor. The quotation entity contains the following attributes; reg no, client name, advisor name, estimate, and date. Similarly, the web search entity will make searches for a product from the internet in order to update the details of a product.Ã
Friday, November 1, 2019
MASTER AND COMMANDER Essay Example | Topics and Well Written Essays - 1250 words
MASTER AND COMMANDER - Essay Example Stephen Maturin and their first adventures. At the same time, there is a historical element to the novel since the backdrop of the story is the war between England and France known as the Napoleonic wars which took place sometime after the French revolution1. In this context, the novel brings together the culture and the history of the times when it starts by placing the action in Port Mahon in 1800. Of course the world was a very different place then and the culture of the time is easily observed in the opening where the first meeting between Aubrey and Maturin is certainly less than ideal. At a Royal Navy base in Port Mahon, Minorca, Jack Aubrey is nudged by Maturin at the governorââ¬â¢s ball during a musical performance. They quibble with each other, but before it can get really serious, Jack is informed that he is about to be given the command of his own ship and he seeks out Maturin to join him on his voyage2. The historical background here is plainly obvious since the cultural elements of challenging someone to a duel and imagined slights at being nudged could certainly not take place in this day and age. At the same time the quick about turn shown by Jack also has its basis in historical fact as it was often difficult to recruit individuals for the hard life of the navy. In fact, Jack has to convince the doctor/scientist/philosopher that the Mediterranean is an excellent place to do research and study3. Of course the place where he conducts this research and study is the HMS Sophie of which the master and commander is Jack Aubrey. The shipââ¬â¢s physician also acts as a reference point for the reader since other characters in the novel explain things to him as the voyage progresses. This explanation of naval matters is also useful for the readers since they also gain awareness about the ship and the manner in which the navy conducts its business4. In the historical context, sailing in the 1800s was quite a different matter as
Wednesday, October 30, 2019
Educational Differences as a Result of Governmental Measures Essay
Educational Differences as a Result of Governmental Measures - Essay Example If education is not taken seriously, it can have very stark outcomes. The educational differences actually start this discussion which can culminate in a number of ramifications. When children are treated differently as per their educational realms, they have a sense of inferiority complex attached to their personalities. They believe it is their right to be on par with the very best and the authorities concerned should ensure the very same (Sharp, 2011). However, this sadly happens, which opens up a plethora of problems for society at large. Since educational differences become manifested within the lives of the people as well, it is only natural to think of it in a very serious manner. When the educational differences are understood from a narrowed down perspective, one finds out that the issue stems from the very top. The role of the government in chalking down proper policies and formulating rules is a missing ingredient of this discussion. They should do their homework well so that there are no anomalies which come about all the same. However, this rarely happens which essentially means that the children are left behind and they lack in having a positive attitude within the varied spheres of the society. The government can enact such measures and coin regulations which will have a direct impact on the educational realms that exist within any society of the world. There must never be a difference, to begin with, such a discussion. This is because education is a right of everyone and no one can deny the very same to anyone (Author Unknown, 2012). What is even more distressing is to know that the educational differences take the backburner of a number of policy mat ters.
Subscribe to:
Posts (Atom)